[SOLUCIONADO] separar String en java

[fuchis]

hola tengo una duda, tengo un archivo .txt con varios caracteres ATGGCCAGGAGAAAAACGATCA , la pregunta es, hay alguna forma de separarlos de forma que queden separadas cada 3 letras, ATG GCC AGG..... para poder meterlas en un vector

[Xerelo]

https://docs.oracle.com/javase/7/doc...ing(int,%20int)

public String substring(int beginIndex, int endIndex)

Returns a new string that is a substring of this string. The substring begins at the specified beginIndex and extends to the character at index endIndex - 1. Thus the length of the substring is endIndex-beginIndex.
Examples:

"hamburger".substring(4, 8) returns "urge"
"smiles".substring(1, 5) returns "mile"

[anderlatorre]

suponiendo que el texto esta en un objeto tipo string "str

Código Java:

String aux="";
for(i=0;i<str.length;i+=3)
 {
 aux+=str.substring(i,i+3)+",";
 }
str=aux;
 

algo así seria la idea,probablemente tenga fallos" index out of bounds"porque lo he hecho rapidamente y sin pensar jeje...

[fuchis]

Iniciado por anderlatorre

suponiendo que el texto esta en un objeto tipo string "str

Código Java:

String aux="";
for(i=0;i<str.length;i+=3)
 {
 aux+=str.substring(i,i+3)+",";
 }
str=aux;
 

algo así seria la idea,probablemente tenga fallos" index out of bounds"porque lo he hecho rapidamente y sin pensar jeje...

gracias funciono